90
|
GenScript corporation
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide+targets/rnase1+crispr+guide+rna++target+sequence++tgccaagggctcatgcacga+/pm38307859-283-32-48 Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
crispr guide rnas targeting cxcr4 hrh1 Crispr Guide Rnas Targeting Cxcr4 Hrh1, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide+targets/crispr+guide+rnas+targeting+cxcr4+hrh1/us11857600-1242-8-29 Average 90 stars, based on 1 article reviews
crispr guide rnas targeting cxcr4 hrh1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Azenta
crispr cas9 guides targeting rve3 Crispr Cas9 Guides Targeting Rve3, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide+targets/cas9+crispr+guides+rve3+targeting/baker_cassandra__2023__examining_roles_for_myb_like_transcription_factor_function_within_the_arabidopsis_circadian_oscillator-199-0-27 Average 86 stars, based on 1 article reviews
crispr cas9 guides targeting rve3 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gcc88 crispr guide rna (grna) plasmid (grna targeting sequence: caactggcctcttcggactt) Gcc88 Crispr Guide Rna (Grna) Plasmid (Grna Targeting Sequence: Caactggcctcttcggactt), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide+targets/gcc88+crispr+guide+rna++grna++plasmid++grna+targeting+sequence++caactggcctcttcggactt+/pm30791178-23-1-14 Average 90 stars, based on 1 article reviews
gcc88 crispr guide rna (grna) plasmid (grna targeting sequence: caactggcctcttcggactt) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
lenti-crispr v2 constructs bearing human klotho targeting guide sequence Lenti Crispr V2 Constructs Bearing Human Klotho Targeting Guide Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide+targets/lenti+crispr+v2+constructs+bearing+human+klotho+targeting+guide+sequence/pm38996716-116-10-28 Average 90 stars, based on 1 article reviews
lenti-crispr v2 constructs bearing human klotho targeting guide sequence - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
86
|
Synthego Inc
crispr guide targets Crispr Guide Targets, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/crispr+guide+targets/crispr+guide+targets/pm42026766-218-16-26 Average 86 stars, based on 1 article reviews
crispr guide targets - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |